|
nif:isString
|
-
Design of the study and selection of subjects: The study was approved by the Ethical Committee of the Faculty of Medicine, Comenius University (FM CU), Bratislava, Slovakia and has been conducted according to the principles expressed in the Declaration of Helsinki. Inclusion criteria for all subjects in our study were: diagnosis of ASD, ages 3–15 and male gender. Exclusion criteria were any reported endocrinological diseases. ASD children in our study were recruited following diagnostic procedures (in the Academic Research Center for Autism, Institute of Physiology, FM CU) after confirming the diagnosis of ASD (see description of diagnostic procedures below). After one parent signs the consent form, 60 boys with ASD between 3 and 15 years of age were enrolled in our study. Parents then completed the Nisonger Child Behavior Rating Form (NCBRF) and venous blood was drawn from boys with ASD according to standardized procedures (see biological measures below). The AR gene is located on the X chromosome. Thus males have just one allele giving number of CAG repeats, while females have two [43]. In order to avoid gender bias and have a homogenous group of individuals, only boys were enrolled in this study.
The diagnosis of ASD was determined in all 60 boys by a clinical psychologist or a psychiatrist according to ICD-10 and DSM-5. The children also underwent behavioral testing by trained examiners at the Academic Research Center for Autism, Institute of Physiology, FM CU. The diagnostic tools involved: observation of a child by the Autism Diagnostic Observation Schedule- second revision (ADOS-2) [44] and the Autism Diagnostic Interview-Revised (ADI-R) [45], a comprehensive interview administered to parents that provides a thorough assessment of individuals with ASD. All children enrolled in the study had to meet the criteria for ASD on both autism scales. The ADOS-2 is a diagnostic tool and a semistructured assessment of social interaction, communication, play, and imaginative use of materials for individuals who may have ASD. It is organized into five modules based on the child’s spoken language level [44]. All the participants were assessed with module 1, 2 or 3. ADOS-2 was administered by trained examiners who were internationally certified to assess ADOS-2 in the clinical and research field and achieved required inter-rater reliability (above 80%). Research indicates substantial inter-rater and test–retest reliability for individual items, excellent inter-rater reliability within domains and excellent internal consistency [internal consistency (Cronbach’s α values) for Modules 1 through 3 were high for the social affect domain (SA) (0.87–0.92) and moderate for the repetitive restricted behavior domain (RRB) (0.51–0.66); test–retest reliability for Modules 1 through 3: SA, RRB, and overall total scores had correlations ranging from 0.68 to 0.92; Inter-rater reliability for SA, RRB, and overall total ranged from 0.79 to 0.98 across the five modules] [44].
Parents of boys with ASD completed the Nisonger child behavior rating form (NCBRF) for intellectual disability [46]. Hyperactivity symptoms were assessed on the hyperactive subscale of NCBRF. The NCBRF for children with intellectual disabilities is a behavior rating scale with good psychometric properties designed for assessment of various behavioral/emotional problems in children and adolescents with intellectual disabilities and ASD [46, 47]. The NCBRF has two Pro-social subscale and six Problem Behavior subscales (Conduct Problem, Insecure/Anxious, Hyperactive, Self-Injury/Stereotypic, Self-Isolated/Ritualistic, Overly Sensitive). The median alpha value for internal consistency was 0.85 for Problem Behavior subscales and 0.78 for the Pro-social subscales [46]. The hyperactive subscale score is the sum of 9 items describing hyperactivity symptoms (e.g., difficulty concentrating, easily distracted, fidgets/wiggles, overactive). Items are rated on a four-point Likert scale. Raters are instructed to consider both the rate of occurrence and the degree to which the behavior was a problem over the last month. Ratings can vary from “did not occur” or “was not a problem” (0) to “occurred a lot” or “was a serious problem” (3). Hyperactivity symptoms were also assessed during direct observation by trained examiners administrating ADOS-2. Although the ADOS-2 is a diagnostic instrument for ASD, except for items relevant to ASD diagnosis there are also items for assessment of various behavioral/emotional problems observed during a 30–60 mins assessment (e.g. anxiety, overactivity, tantrums/aggression). For our analyses we used an overactivity item that is rated on a four-point Likert scale ranging from absence of problem behavior (0), mild problem behavior (1), moderate problem behavior (2) to marked problem behavior (3). Scores for the item are the same through all the modules.
Venous blood samples were drawn from all 60 children into sterile polypropylene tubes containing K2 EDTA (Sarstedt, Nümbrecht, Germany) using standardized procedures the same month of the year from 8:00 to 10:00 a.m. in respect of the circadian [48,49] and infradian [50,51] rhythm of testosterone fluctuations from all children at the Pediatric Department of Children Faculty Hospital CU in Bratislava. Whole blood samples were centrifuged for 5 min at 2000 g immediately after collection. Plasma aliquots were stored at −20°C for not longer than one month. On the day of testing, frozen samples were brought to room temperature and pipetted on to a testing plate. The ELISA assay using a commercial Testosterone ELISA kit was used according to manufacturer's instructions (DRG Instruments GmbH, Marburg, Germany). The intra-assay coefficient of variation was lower than 5% and the inter-assay coefficient of variation was 10%in every measurement. Unfortunately, plasmatic testosterone levels were measured only in 40 boys due to lack of blood sample volumes.
Number of CAG repeats- measurement of AR sensitivity: Genomic DNA from whole blood was extracted using the silica membrane based kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions (QIAamp DNA Blood Mini Kit Handbook 04/2010) according to DNA purification protocol for blood/body fluids. The (CAG)n repeat polymorphism in exon 1 of the gene encoding AR was amplified using PCR in 20 μl reaction volume with 250 nmol/L primers: forward:5´ GCGCGAAGTGATCCAGAAC 3´ tagged with 6–carboxyfluoresce in and reverse 5´ CTCATCCAGGACCAGGTAGC 3´, 1× Taq buffer (Fermentas, Vilnius, Lithuania) and 1U of Taq DNA polymerase (Fermentas, Vilnius, Lithuania). The following PCR program was used: initial denaturation step at 94°C for 4 min, followed by 35 cycles each consisting of denaturation at 94°C for 45 s, annealing at 59.5°C for 45 s and polymerization at 72°C for 45 s. The length of the final fragment was 181 bps. The number of repeats was analyzed by capillary electrophoresis. The number of CAG triplets was determined in all 60 boys.
In order to determine a relationship between biological aspects and behavioral problems statistical analyses were done using IBM SPSS 20 (IBM SPSS 20, Chicago, USA). Before all statistical analyses testosterone levels were log10 transformed in order to achieve a normal distribution. Simple linear correlations and simple linear regression, between biological measures (testosterone, number of CAG repeats), behavioral scores on the hyperactivity subscale of NCBRF, and age were conducted.
Simple linear correlations and simple linear regression, between biological measures (testosterone, number of CAG repeats), behavioral scores on overactivity item in ADOS-2 and age were conducted. To confirm significance after adjustment for age multiple linear regression was used.
|
![[This page as RDF]](http://data.gesis.org/somesci/static/rdf-icon.gif){kind=icon}