|
nif:isString
|
-
Gamma4 was targeted by the reverse primer γ4R1 (5′- GTGCTACAATGGCGCATACA -3′) using a PCR protocol with initial denaturation of 94°C for 4 min followed by a 11 touchdown cycles of 30 s denaturation at 94°C, 20 s annealing step declining from 57°C to 46°C, and 1.5 min elongation step at 72°C, then 30 standard cycles with annealing at 46°C and final extension at 72°C for 5 min.
|
![[This page as RDF]](http://data.gesis.org/somesci/static/rdf-icon.gif){kind=icon}